paper n a pgl3 basic empty Search Results


pgl 3.1  (Promega)
90
Promega pgl 3.1
Pgl 3.1, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pgl3+basic+empty/pgl3+basic/pmc05777338-707-305-309
Average 90 stars, based on 1 article reviews
pgl 3.1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
paper n a pgl3 basic pd l1 promoter  (Addgene inc)
95
Addgene inc paper n a pgl3 basic pd l1 promoter
Paper N A Pgl3 Basic Pd L1 Promoter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pgl3+basic+empty/pGL3+(-BRE)+Luciferase+(Plasmid+%2345127)/pm37405918-135-166-182
Average 95 stars, based on 1 article reviews
paper n a pgl3 basic pd l1 promoter - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier
paper n a recombinant dna ifn beta pgl3 addgene  (Addgene inc)
94
Addgene inc paper n a recombinant dna ifn beta pgl3 addgene
Paper N A Recombinant Dna Ifn Beta Pgl3 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pgl3+basic+empty/IFN-Beta_pGL3+(Plasmid+%23102597)/pm37624697-175-46-52
Average 94 stars, based on 1 article reviews
paper n a recombinant dna ifn beta pgl3 addgene - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
paper n a pgl3  (Obio Technology Corp Ltd)
86
Obio Technology Corp Ltd paper n a pgl3
Figure 4. Metrnl regulates PC biosynthesis and TG secretion via the Sp1/CCTa axis (A) The Kennedy pathway for PC biosynthesis. (B and C) FFA-treated HepG2 cells were transfected with an adenovirus for 48 h, and the mRNA levels of the genes involved in PC biosynthesis (B) and the protein levels of Sp1 and the genes involved in PC biosynthesis (C). (D and E) Protein levels in FFA-treated AML12 cells (D) and primary hepatocytes from LKO-Met mice and L-WT mice (E). (F–H) The expression levels were measured in the livers of HFD-fed and HFD-rMet mice using qPCR (F), WB (G), and IHC (H) (n = 5). (I) Sp1 expression was detected in the nuclear extracts of FFA-treated HepG2 cells 48 h after the adenovirus infection (n = 3). (J–L) Sp1 and CCTa expression (J) and PC (K) and TG contents (L) were determined in FFA-treated HepG2 cells transfected with the adenovirus and incubated with 100 nmol/L Mith (an Sp1-specific inhibitor) for 24 h (n = 3). (M) A dual-luciferase assay was performed in HEK293T cells 24 h after the transfection of a CCTa-promoter plasmid and adenovirus infection, and the empty plasmid <t>pGL3</t> was used as a control (n = 3). (N) qPCR analysis of the levels of the CCTa promoter enriched with an anti-Sp1 antibody or an immunoglobulin G (IgG) antibody via a ChIP assay in Metrnl- overexpressing or control HepG2 cells. Mith, mithramycin. The data are presented as the mean ± SD. *p < 0.05 and **p < 0.01 compared with the Ad-Vec, sh-NC, or HFD groups.
Paper N A Pgl3, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pgl3+basic+empty/a+n+paper+pgl3/pm39918960-217-70-64
Average 86 stars, based on 1 article reviews
paper n a pgl3 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
paper n a m69 pcmv pgl3 luciferase  (Addgene inc)
92
Addgene inc paper n a m69 pcmv pgl3 luciferase
Figure 4. Metrnl regulates PC biosynthesis and TG secretion via the Sp1/CCTa axis (A) The Kennedy pathway for PC biosynthesis. (B and C) FFA-treated HepG2 cells were transfected with an adenovirus for 48 h, and the mRNA levels of the genes involved in PC biosynthesis (B) and the protein levels of Sp1 and the genes involved in PC biosynthesis (C). (D and E) Protein levels in FFA-treated AML12 cells (D) and primary hepatocytes from LKO-Met mice and L-WT mice (E). (F–H) The expression levels were measured in the livers of HFD-fed and HFD-rMet mice using qPCR (F), WB (G), and IHC (H) (n = 5). (I) Sp1 expression was detected in the nuclear extracts of FFA-treated HepG2 cells 48 h after the adenovirus infection (n = 3). (J–L) Sp1 and CCTa expression (J) and PC (K) and TG contents (L) were determined in FFA-treated HepG2 cells transfected with the adenovirus and incubated with 100 nmol/L Mith (an Sp1-specific inhibitor) for 24 h (n = 3). (M) A dual-luciferase assay was performed in HEK293T cells 24 h after the transfection of a CCTa-promoter plasmid and adenovirus infection, and the empty plasmid <t>pGL3</t> was used as a control (n = 3). (N) qPCR analysis of the levels of the CCTa promoter enriched with an anti-Sp1 antibody or an immunoglobulin G (IgG) antibody via a ChIP assay in Metrnl- overexpressing or control HepG2 cells. Mith, mithramycin. The data are presented as the mean ± SD. *p < 0.05 and **p < 0.01 compared with the Ad-Vec, sh-NC, or HFD groups.
Paper N A M69 Pcmv Pgl3 Luciferase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pgl3+basic+empty/M69+pCMV+pGL3+Luciferase+(Plasmid+%2317186)/pm29220666-278-191-203
Average 92 stars, based on 1 article reviews
paper n a m69 pcmv pgl3 luciferase - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
paper n a puc19 top2a 5x gly venus t2a hygro  (Addgene inc)
90
Addgene inc paper n a puc19 top2a 5x gly venus t2a hygro
Figure 4. Metrnl regulates PC biosynthesis and TG secretion via the Sp1/CCTa axis (A) The Kennedy pathway for PC biosynthesis. (B and C) FFA-treated HepG2 cells were transfected with an adenovirus for 48 h, and the mRNA levels of the genes involved in PC biosynthesis (B) and the protein levels of Sp1 and the genes involved in PC biosynthesis (C). (D and E) Protein levels in FFA-treated AML12 cells (D) and primary hepatocytes from LKO-Met mice and L-WT mice (E). (F–H) The expression levels were measured in the livers of HFD-fed and HFD-rMet mice using qPCR (F), WB (G), and IHC (H) (n = 5). (I) Sp1 expression was detected in the nuclear extracts of FFA-treated HepG2 cells 48 h after the adenovirus infection (n = 3). (J–L) Sp1 and CCTa expression (J) and PC (K) and TG contents (L) were determined in FFA-treated HepG2 cells transfected with the adenovirus and incubated with 100 nmol/L Mith (an Sp1-specific inhibitor) for 24 h (n = 3). (M) A dual-luciferase assay was performed in HEK293T cells 24 h after the transfection of a CCTa-promoter plasmid and adenovirus infection, and the empty plasmid <t>pGL3</t> was used as a control (n = 3). (N) qPCR analysis of the levels of the CCTa promoter enriched with an anti-Sp1 antibody or an immunoglobulin G (IgG) antibody via a ChIP assay in Metrnl- overexpressing or control HepG2 cells. Mith, mithramycin. The data are presented as the mean ± SD. *p < 0.05 and **p < 0.01 compared with the Ad-Vec, sh-NC, or HFD groups.
Paper N A Puc19 Top2a 5x Gly Venus T2a Hygro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pgl3+basic+empty/pGL3-basic-Polr2a+promoter_600bps+(Plasmid+%2321111)/pm38521067-267-61-74
Average 90 stars, based on 1 article reviews
paper n a puc19 top2a 5x gly venus t2a hygro - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
paper n a pgl3  (Addgene inc)
94
Addgene inc paper n a pgl3
Figure 4. Metrnl regulates PC biosynthesis and TG secretion via the Sp1/CCTa axis (A) The Kennedy pathway for PC biosynthesis. (B and C) FFA-treated HepG2 cells were transfected with an adenovirus for 48 h, and the mRNA levels of the genes involved in PC biosynthesis (B) and the protein levels of Sp1 and the genes involved in PC biosynthesis (C). (D and E) Protein levels in FFA-treated AML12 cells (D) and primary hepatocytes from LKO-Met mice and L-WT mice (E). (F–H) The expression levels were measured in the livers of HFD-fed and HFD-rMet mice using qPCR (F), WB (G), and IHC (H) (n = 5). (I) Sp1 expression was detected in the nuclear extracts of FFA-treated HepG2 cells 48 h after the adenovirus infection (n = 3). (J–L) Sp1 and CCTa expression (J) and PC (K) and TG contents (L) were determined in FFA-treated HepG2 cells transfected with the adenovirus and incubated with 100 nmol/L Mith (an Sp1-specific inhibitor) for 24 h (n = 3). (M) A dual-luciferase assay was performed in HEK293T cells 24 h after the transfection of a CCTa-promoter plasmid and adenovirus infection, and the empty plasmid <t>pGL3</t> was used as a control (n = 3). (N) qPCR analysis of the levels of the CCTa promoter enriched with an anti-Sp1 antibody or an immunoglobulin G (IgG) antibody via a ChIP assay in Metrnl- overexpressing or control HepG2 cells. Mith, mithramycin. The data are presented as the mean ± SD. *p < 0.05 and **p < 0.01 compared with the Ad-Vec, sh-NC, or HFD groups.
Paper N A Pgl3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pgl3+basic+empty/pGL3+(Plasmid+%2348743)/pm36680774-546-140-168
Average 94 stars, based on 1 article reviews
paper n a pgl3 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
paper n a pgl3 control vector promega rrid addgene 212937 reporter backbone  (Addgene inc)
93
Addgene inc paper n a pgl3 control vector promega rrid addgene 212937 reporter backbone
Figure 4. Metrnl regulates PC biosynthesis and TG secretion via the Sp1/CCTa axis (A) The Kennedy pathway for PC biosynthesis. (B and C) FFA-treated HepG2 cells were transfected with an adenovirus for 48 h, and the mRNA levels of the genes involved in PC biosynthesis (B) and the protein levels of Sp1 and the genes involved in PC biosynthesis (C). (D and E) Protein levels in FFA-treated AML12 cells (D) and primary hepatocytes from LKO-Met mice and L-WT mice (E). (F–H) The expression levels were measured in the livers of HFD-fed and HFD-rMet mice using qPCR (F), WB (G), and IHC (H) (n = 5). (I) Sp1 expression was detected in the nuclear extracts of FFA-treated HepG2 cells 48 h after the adenovirus infection (n = 3). (J–L) Sp1 and CCTa expression (J) and PC (K) and TG contents (L) were determined in FFA-treated HepG2 cells transfected with the adenovirus and incubated with 100 nmol/L Mith (an Sp1-specific inhibitor) for 24 h (n = 3). (M) A dual-luciferase assay was performed in HEK293T cells 24 h after the transfection of a CCTa-promoter plasmid and adenovirus infection, and the empty plasmid <t>pGL3</t> was used as a control (n = 3). (N) qPCR analysis of the levels of the CCTa promoter enriched with an anti-Sp1 antibody or an immunoglobulin G (IgG) antibody via a ChIP assay in Metrnl- overexpressing or control HepG2 cells. Mith, mithramycin. The data are presented as the mean ± SD. *p < 0.05 and **p < 0.01 compared with the Ad-Vec, sh-NC, or HFD groups.
Paper N A Pgl3 Control Vector Promega Rrid Addgene 212937 Reporter Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pgl3+basic+empty/pRF%2B275Dux4+(Plasmid+%2321293)/pm40138313-265-16-22
Average 93 stars, based on 1 article reviews
paper n a pgl3 control vector promega rrid addgene 212937 reporter backbone - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
paper n a pgl3 stub1 p mut  (Addgene inc)
92
Addgene inc paper n a pgl3 stub1 p mut
Figure 4. Metrnl regulates PC biosynthesis and TG secretion via the Sp1/CCTa axis (A) The Kennedy pathway for PC biosynthesis. (B and C) FFA-treated HepG2 cells were transfected with an adenovirus for 48 h, and the mRNA levels of the genes involved in PC biosynthesis (B) and the protein levels of Sp1 and the genes involved in PC biosynthesis (C). (D and E) Protein levels in FFA-treated AML12 cells (D) and primary hepatocytes from LKO-Met mice and L-WT mice (E). (F–H) The expression levels were measured in the livers of HFD-fed and HFD-rMet mice using qPCR (F), WB (G), and IHC (H) (n = 5). (I) Sp1 expression was detected in the nuclear extracts of FFA-treated HepG2 cells 48 h after the adenovirus infection (n = 3). (J–L) Sp1 and CCTa expression (J) and PC (K) and TG contents (L) were determined in FFA-treated HepG2 cells transfected with the adenovirus and incubated with 100 nmol/L Mith (an Sp1-specific inhibitor) for 24 h (n = 3). (M) A dual-luciferase assay was performed in HEK293T cells 24 h after the transfection of a CCTa-promoter plasmid and adenovirus infection, and the empty plasmid <t>pGL3</t> was used as a control (n = 3). (N) qPCR analysis of the levels of the CCTa promoter enriched with an anti-Sp1 antibody or an immunoglobulin G (IgG) antibody via a ChIP assay in Metrnl- overexpressing or control HepG2 cells. Mith, mithramycin. The data are presented as the mean ± SD. *p < 0.05 and **p < 0.01 compared with the Ad-Vec, sh-NC, or HFD groups.
Paper N A Pgl3 Stub1 P Mut, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pgl3+basic+empty/pGL3-OF+(mutant+TCF-4+sites)+(Plasmid+%2316559)/pm35675767-146-124-162
Average 92 stars, based on 1 article reviews
paper n a pgl3 stub1 p mut - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

Image Search Results


Figure 4. Metrnl regulates PC biosynthesis and TG secretion via the Sp1/CCTa axis (A) The Kennedy pathway for PC biosynthesis. (B and C) FFA-treated HepG2 cells were transfected with an adenovirus for 48 h, and the mRNA levels of the genes involved in PC biosynthesis (B) and the protein levels of Sp1 and the genes involved in PC biosynthesis (C). (D and E) Protein levels in FFA-treated AML12 cells (D) and primary hepatocytes from LKO-Met mice and L-WT mice (E). (F–H) The expression levels were measured in the livers of HFD-fed and HFD-rMet mice using qPCR (F), WB (G), and IHC (H) (n = 5). (I) Sp1 expression was detected in the nuclear extracts of FFA-treated HepG2 cells 48 h after the adenovirus infection (n = 3). (J–L) Sp1 and CCTa expression (J) and PC (K) and TG contents (L) were determined in FFA-treated HepG2 cells transfected with the adenovirus and incubated with 100 nmol/L Mith (an Sp1-specific inhibitor) for 24 h (n = 3). (M) A dual-luciferase assay was performed in HEK293T cells 24 h after the transfection of a CCTa-promoter plasmid and adenovirus infection, and the empty plasmid pGL3 was used as a control (n = 3). (N) qPCR analysis of the levels of the CCTa promoter enriched with an anti-Sp1 antibody or an immunoglobulin G (IgG) antibody via a ChIP assay in Metrnl- overexpressing or control HepG2 cells. Mith, mithramycin. The data are presented as the mean ± SD. *p < 0.05 and **p < 0.01 compared with the Ad-Vec, sh-NC, or HFD groups.

Journal: Cell reports

Article Title: Meteorin-like alleviates hepatic steatosis by regulating hepatic triglyceride secretion and fatty acid oxidation.

doi: 10.1016/j.celrep.2025.115246

Figure Lengend Snippet: Figure 4. Metrnl regulates PC biosynthesis and TG secretion via the Sp1/CCTa axis (A) The Kennedy pathway for PC biosynthesis. (B and C) FFA-treated HepG2 cells were transfected with an adenovirus for 48 h, and the mRNA levels of the genes involved in PC biosynthesis (B) and the protein levels of Sp1 and the genes involved in PC biosynthesis (C). (D and E) Protein levels in FFA-treated AML12 cells (D) and primary hepatocytes from LKO-Met mice and L-WT mice (E). (F–H) The expression levels were measured in the livers of HFD-fed and HFD-rMet mice using qPCR (F), WB (G), and IHC (H) (n = 5). (I) Sp1 expression was detected in the nuclear extracts of FFA-treated HepG2 cells 48 h after the adenovirus infection (n = 3). (J–L) Sp1 and CCTa expression (J) and PC (K) and TG contents (L) were determined in FFA-treated HepG2 cells transfected with the adenovirus and incubated with 100 nmol/L Mith (an Sp1-specific inhibitor) for 24 h (n = 3). (M) A dual-luciferase assay was performed in HEK293T cells 24 h after the transfection of a CCTa-promoter plasmid and adenovirus infection, and the empty plasmid pGL3 was used as a control (n = 3). (N) qPCR analysis of the levels of the CCTa promoter enriched with an anti-Sp1 antibody or an immunoglobulin G (IgG) antibody via a ChIP assay in Metrnl- overexpressing or control HepG2 cells. Mith, mithramycin. The data are presented as the mean ± SD. *p < 0.05 and **p < 0.01 compared with the Ad-Vec, sh-NC, or HFD groups.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer 4 for CHIP: ACTGTGACGGAAGTGAGGCT CTTTCGCGCCCTTCCCAT Sangon Biotech N/A Primer 5 for CHIP: CTTTCTGCGGAGGTAAAGGAGA ATCCGCTCCCAAAACGGTA Sangon Biotech N/A Primer 6 for CHIP: GTCTCAAAACCCTGCCGC CTCCTTTACCTCCGCAGAAA Sangon Biotech N/A shRNA-Metrnl: CAAGGACTTCCAGAGGATGT N/A N/A Recombinant DNA AAV8-Metrnl HANBIO N/A AAV8-Vector HANBIO N/A Ad-mouse Metrnl OBiO Technology Corp.Ltd N/A Ad-mouse Vector OBiO Technology Corp.Ltd N/A Ad-human Metrnl OBiO Technology Corp.Ltd N/A Ad-human Vector OBiO Technology Corp.Ltd N/A pGL3-CCTa-promotor This paper N/A pGL3 This paper N/A sh-Metrnl OBiO Technology Corp.Ltd N/A sh-Vector OBiO Technology Corp.Ltd N/A Software and algorithms GraphPad Prism 9.03 GraphPad Software https://www.graphpad.com/features EndNote X8 EndNote https://endnote.com/ Adobe Illustrator Adobe https://www.adobe.com/ ImageJ NIH https://imagej.net/ij/ Adobe Photoshop Adobe https://www.adobe.com/ Other Ethical approval of the human tissue array Life Sciences Ethics Committee of Changsha Yaxiang Biotechnology Co., LTD. Csyayj2024093

Techniques: Transfection, Expressing, Infection, Incubation, Luciferase, Plasmid Preparation, Control